ID: 1166470186_1166470194

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1166470186 1166470194
Species Human (GRCh38) Human (GRCh38)
Location 19:43073014-43073036 19:43073057-43073079
Sequence CCCCCCTAGATGTGATTTCTCTG ATTCTAGAGATCAGTAATAATGG
Strand - +
Off-target summary No data {0: 2, 1: 7, 2: 3, 3: 13, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!