ID: 1166473057_1166473062

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1166473057 1166473062
Species Human (GRCh38) Human (GRCh38)
Location 19:43096818-43096840 19:43096868-43096890
Sequence CCAAACTTCCTCTGTGTTCACTG GTTTCTCCCATCACAAGCTGTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 5, 3: 28, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!