ID: 1166483456_1166483460

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166483456 1166483460
Species Human (GRCh38) Human (GRCh38)
Location 19:43192854-43192876 19:43192902-43192924
Sequence CCATCTTCTCTGCAAACACACAG TGGGAGCCCTGTATGCAAGATGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 5, 3: 68, 4: 600} {0: 2, 1: 6, 2: 2, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!