ID: 1166485223_1166485230

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1166485223 1166485230
Species Human (GRCh38) Human (GRCh38)
Location 19:43206459-43206481 19:43206479-43206501
Sequence CCAGGAACCCCGCGGGACATGGC GGCTTGTTGAGACGCAGGAGGGG
Strand - +
Off-target summary {0: 4, 1: 4, 2: 1, 3: 5, 4: 90} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!