ID: 1166486729_1166486734

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1166486729 1166486734
Species Human (GRCh38) Human (GRCh38)
Location 19:43220357-43220379 19:43220407-43220429
Sequence CCAAACTTCCTCTGTGTTCACTG GTTTCTCCCATCACAAGCTGTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 5, 3: 28, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!