ID: 1166491763_1166491769

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1166491763 1166491769
Species Human (GRCh38) Human (GRCh38)
Location 19:43266494-43266516 19:43266523-43266545
Sequence CCTCTCCTTGATCCTCTCATGAC ATGGACACTTTGGGAAACACAGG
Strand - +
Off-target summary {0: 8, 1: 2, 2: 1, 3: 19, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!