ID: 1166602186_1166602188

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1166602186 1166602188
Species Human (GRCh38) Human (GRCh38)
Location 19:44106456-44106478 19:44106477-44106499
Sequence CCTTCCAGCAAATCTGGGAAAAA AAATTGCAAGTGATTTAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 290} {0: 2, 1: 1, 2: 5, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!