ID: 1167045401_1167045409

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1167045401 1167045409
Species Human (GRCh38) Human (GRCh38)
Location 19:47046252-47046274 19:47046275-47046297
Sequence CCTGCGGGAGAGGCAGGGTAGCA ACAGGGCCAAGGTCGGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 243} {0: 1, 1: 0, 2: 3, 3: 37, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!