ID: 1167045401_1167045412

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1167045401 1167045412
Species Human (GRCh38) Human (GRCh38)
Location 19:47046252-47046274 19:47046281-47046303
Sequence CCTGCGGGAGAGGCAGGGTAGCA CCAAGGTCGGGGGATGGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 243} {0: 1, 1: 0, 2: 1, 3: 25, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!