ID: 1167251095_1167251111

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1167251095 1167251111
Species Human (GRCh38) Human (GRCh38)
Location 19:48398810-48398832 19:48398861-48398883
Sequence CCCATCGTGGCCGTGCACGGCGG CGCGCGACCGGGGCGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 150} {0: 1, 1: 1, 2: 11, 3: 115, 4: 729}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!