ID: 1167251097_1167251106

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1167251097 1167251106
Species Human (GRCh38) Human (GRCh38)
Location 19:48398811-48398833 19:48398854-48398876
Sequence CCATCGTGGCCGTGCACGGCGGC CAAGGTGCGCGCGACCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 285} {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!