ID: 1167358919_1167358928

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1167358919 1167358928
Species Human (GRCh38) Human (GRCh38)
Location 19:49019658-49019680 19:49019672-49019694
Sequence CCCCGCGGTGGTGGTCTGCGAGT TCTGCGAGTTGTGGGGGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!