ID: 1167358919_1167358930

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1167358919 1167358930
Species Human (GRCh38) Human (GRCh38)
Location 19:49019658-49019680 19:49019688-49019710
Sequence CCCCGCGGTGGTGGTCTGCGAGT GCTGGGGCCCGAAGTATTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 25} {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!