ID: 1167362153_1167362171

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1167362153 1167362171
Species Human (GRCh38) Human (GRCh38)
Location 19:49036034-49036056 19:49036083-49036105
Sequence CCGCAGCCCCTGACCAGAGAGGC CTGTGGGTCTGGCCCTGAGGTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 1, 3: 40, 4: 377} {0: 7, 1: 0, 2: 2, 3: 37, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!