ID: 1167363913_1167363931

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1167363913 1167363931
Species Human (GRCh38) Human (GRCh38)
Location 19:49044775-49044797 19:49044824-49044846
Sequence CCACCTCAGGGCCAGACCCACAG GCCTCTCTGGTCAGGGGCTGCGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 37, 4: 363} {0: 6, 1: 0, 2: 1, 3: 40, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!