ID: 1167380163_1167380173

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1167380163 1167380173
Species Human (GRCh38) Human (GRCh38)
Location 19:49133846-49133868 19:49133888-49133910
Sequence CCAGCTGGAAGAGAAGAATCAAG GCGGAAGACTGCACAGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 285} {0: 1, 1: 0, 2: 1, 3: 20, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!