ID: 1167702106_1167702116

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1167702106 1167702116
Species Human (GRCh38) Human (GRCh38)
Location 19:51054955-51054977 19:51054988-51055010
Sequence CCCCTTCCCCTTCTCCTTCTCCT AGGGTCTTGCTCTGTCACCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!