ID: 1167745952_1167745964

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1167745952 1167745964
Species Human (GRCh38) Human (GRCh38)
Location 19:51351992-51352014 19:51352043-51352065
Sequence CCTTCCCTGGTTGAGGCCATGAG CTGAGCAGAGGTGGTGCCCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 2, 3: 18, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!