ID: 1167787254_1167787271

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1167787254 1167787271
Species Human (GRCh38) Human (GRCh38)
Location 19:51646487-51646509 19:51646538-51646560
Sequence CCGTCCCGGAACCAGTAGACGTA CAGGGGTAAGAGAAGGAGCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 30} {0: 2, 1: 0, 2: 11, 3: 91, 4: 816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!