ID: 1167924342_1167924347

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1167924342 1167924347
Species Human (GRCh38) Human (GRCh38)
Location 19:52810913-52810935 19:52810928-52810950
Sequence CCCTCCACAGTCTCCCTCTGATG CTCTGATGCCGAGCCAAAGCTGG
Strand - +
Off-target summary {0: 4, 1: 88, 2: 17, 3: 35, 4: 370} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!