ID: 1168004233_1168004236

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1168004233 1168004236
Species Human (GRCh38) Human (GRCh38)
Location 19:53473366-53473388 19:53473397-53473419
Sequence CCTCCAGCTTCAGCTGTGCATAG GCCTCCAGAGTGACCAGAGCAGG
Strand - +
Off-target summary No data {0: 3, 1: 6, 2: 19, 3: 48, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!