ID: 1168171773_1168171789

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1168171773 1168171789
Species Human (GRCh38) Human (GRCh38)
Location 19:54594487-54594509 19:54594526-54594548
Sequence CCCCAGCTCTCCCAGGTCCCTCC GGGGCCACCCCCGTGCAGCTGGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 14, 3: 99, 4: 785} {0: 2, 1: 2, 2: 0, 3: 21, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!