ID: 1168224236_1168224240

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1168224236 1168224240
Species Human (GRCh38) Human (GRCh38)
Location 19:54982890-54982912 19:54982920-54982942
Sequence CCCGCGGTGTGCTGGATCGTGTG CTGAAGCTGCAGATGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 76} {0: 2, 1: 1, 2: 3, 3: 58, 4: 549}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!