ID: 1168403481_1168403485

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1168403481 1168403485
Species Human (GRCh38) Human (GRCh38)
Location 19:56099063-56099085 19:56099081-56099103
Sequence CCTGCAGGCCAGCTGCCCGAGAA GAGAACATATCAAGTCCTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!