ID: 1168476611_1168476621

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1168476611 1168476621
Species Human (GRCh38) Human (GRCh38)
Location 19:56680405-56680427 19:56680437-56680459
Sequence CCCAACCAGGTTGGCCCATAAAA AGCAGGAGTGTTGTGGGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 52, 4: 618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!