ID: 1168662998_1168663011

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1168662998 1168663011
Species Human (GRCh38) Human (GRCh38)
Location 19:58182648-58182670 19:58182692-58182714
Sequence CCTCCGAGTTTCCCTCCCCTCCC CCCTGTCCACCCTCACTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 630} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!