ID: 1168877998_1168878009

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1168877998 1168878009
Species Human (GRCh38) Human (GRCh38)
Location 20:1184698-1184720 20:1184728-1184750
Sequence CCCGCAGGGGCCCAATACCCCAC GCGCACTGACACCCGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105} {0: 1, 1: 0, 2: 0, 3: 9, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!