ID: 1168878000_1168878009

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1168878000 1168878009
Species Human (GRCh38) Human (GRCh38)
Location 20:1184708-1184730 20:1184728-1184750
Sequence CCCAATACCCCACCCGCCGCGCG GCGCACTGACACCCGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38} {0: 1, 1: 0, 2: 0, 3: 9, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!