ID: 1169584696_1169584703

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1169584696 1169584703
Species Human (GRCh38) Human (GRCh38)
Location 20:7068072-7068094 20:7068121-7068143
Sequence CCTTTACTTTACATCTCTCAAAC CCTCACAATGCTGTATTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!