ID: 1169623807_1169623817

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1169623807 1169623817
Species Human (GRCh38) Human (GRCh38)
Location 20:7540144-7540166 20:7540175-7540197
Sequence CCCCCACCCACCAGCAGTGGAAC GAGAGAGAATCTGTGTGCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!