ID: 1169623807_1169623820

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1169623807 1169623820
Species Human (GRCh38) Human (GRCh38)
Location 20:7540144-7540166 20:7540180-7540202
Sequence CCCCCACCCACCAGCAGTGGAAC AGAATCTGTGTGCCTGGGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!