ID: 1170000029_1170000032 |
View in Genome Browser |
Spacer: -4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1170000029 | 1170000032 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 20:11605425-11605447 | 20:11605444-11605466 |
| Sequence | CCCAGTTGCTTCTCTCTACTTTA | TTTAGGATTAAAGATTAACTAGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 4, 2: 2, 3: 32, 4: 293} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||