ID: 1171212585_1171212590

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1171212585 1171212590
Species Human (GRCh38) Human (GRCh38)
Location 20:23328137-23328159 20:23328150-23328172
Sequence CCGAAGGTCTCCCCAGCAGCCGG CAGCAGCCGGCACCCTGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 596} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!