ID: 1171293465_1171293471

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1171293465 1171293471
Species Human (GRCh38) Human (GRCh38)
Location 20:23995751-23995773 20:23995770-23995792
Sequence CCTCCATGCTTCTGTTTTCTTTG TTTGAGCCAGGTGGTCAGGAGGG
Strand - +
Off-target summary {0: 10, 1: 0, 2: 6, 3: 100, 4: 772} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!