ID: 1171396218_1171396229

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1171396218 1171396229
Species Human (GRCh38) Human (GRCh38)
Location 20:24835450-24835472 20:24835490-24835512
Sequence CCTTCACCATGATCCAGTGAGAC GGTTGAACGGAGGTAGGAAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!