ID: 1171500915_1171500920

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1171500915 1171500920
Species Human (GRCh38) Human (GRCh38)
Location 20:25592681-25592703 20:25592701-25592723
Sequence CCAAGGAGGCCGATCTTGCTCCT CCTTGCCTGCTGCTGTCCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 49, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!