ID: 1171554131_1171554137

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1171554131 1171554137
Species Human (GRCh38) Human (GRCh38)
Location 20:26068228-26068250 20:26068274-26068296
Sequence CCCAAGTTCCTCTGACCAGACAG TCCACTTCGGCACACACACCTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 9, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!