ID: 1171723354_1171723359

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1171723354 1171723359
Species Human (GRCh38) Human (GRCh38)
Location 20:28589616-28589638 20:28589646-28589668
Sequence CCCTTGTCCATTTTTCTATTCAG TGTTCGCAATTTTTCTACTGGGG
Strand - +
Off-target summary No data {0: 6, 1: 2, 2: 4, 3: 10, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!