ID: 1171898114_1171898116

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1171898114 1171898116
Species Human (GRCh38) Human (GRCh38)
Location 20:30829599-30829621 20:30829615-30829637
Sequence CCTGTGAATTTGGGAGAGGGAGA AGGGAGAGCACAGTGACTGGAGG
Strand - +
Off-target summary {0: 8, 1: 2, 2: 3, 3: 33, 4: 311} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!