ID: 1172008631_1172008635

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1172008631 1172008635
Species Human (GRCh38) Human (GRCh38)
Location 20:31833828-31833850 20:31833855-31833877
Sequence CCACACAGTGGCCGGGGCTGAAG ACAGCCCAGAAGGCCAGAAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 17, 4: 176} {0: 1, 1: 0, 2: 1, 3: 31, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!