ID: 1172222414_1172222421

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1172222414 1172222421
Species Human (GRCh38) Human (GRCh38)
Location 20:33283065-33283087 20:33283114-33283136
Sequence CCAAGGCTGCCTCCGGGCGGGGC TTACCTTGGAGACCTCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 451} {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!