ID: 1172570703_1172570713

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1172570703 1172570713
Species Human (GRCh38) Human (GRCh38)
Location 20:35968140-35968162 20:35968193-35968215
Sequence CCACTTTCAATCACATGCAAATT GGTTAATGCAAATTAAGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 9, 3: 22, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!