ID: 1173176988_1173176991

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1173176988 1173176991
Species Human (GRCh38) Human (GRCh38)
Location 20:40771928-40771950 20:40771942-40771964
Sequence CCCGGGAATCTGGCAGCCACTCT AGCCACTCTCTGGCCAGAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!