ID: 1173463604_1173463614

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1173463604 1173463614
Species Human (GRCh38) Human (GRCh38)
Location 20:43263392-43263414 20:43263443-43263465
Sequence CCCTCCCCGACACACACACATAA TTTTGAGATAAACAAAACCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 32, 3: 285, 4: 2005} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!