ID: 1173605236_1173605252

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1173605236 1173605252
Species Human (GRCh38) Human (GRCh38)
Location 20:44326917-44326939 20:44326951-44326973
Sequence CCGGGGCACGGCCTTGACCCCGG CCCGCGCGGCACAGGAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!