ID: 1173794606_1173794609 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1173794606 | 1173794609 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 20:45850534-45850556 | 20:45850551-45850573 |
| Sequence | CCATTGTCTGTTTGTATATTCAG | ATTCAGCCTCTCCCAGGCAAGGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 11, 2: 50, 3: 115, 4: 454} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||