ID: 1173999344_1173999347

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1173999344 1173999347
Species Human (GRCh38) Human (GRCh38)
Location 20:47362949-47362971 20:47362975-47362997
Sequence CCCACATCAAGAAGCACAACTGT GTGATTGAGTGTGTGGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!