ID: 1174112175_1174112176

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1174112175 1174112176
Species Human (GRCh38) Human (GRCh38)
Location 20:48204608-48204630 20:48204622-48204644
Sequence CCAGGCGAGGTTTTGGCTTTCGT GGCTTTCGTGCTGAGCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!