ID: 1174392914_1174392922

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1174392914 1174392922
Species Human (GRCh38) Human (GRCh38)
Location 20:50228911-50228933 20:50228948-50228970
Sequence CCCTCTATCCAACCAGCCCCACA TGTTTATTTCTTGTTACTGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!