ID: 1175349810_1175349821

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1175349810 1175349821
Species Human (GRCh38) Human (GRCh38)
Location 20:58309779-58309801 20:58309817-58309839
Sequence CCGGCTGCTAAGGCGGGCCCCAC CAGGCCGGACCTACGGCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 75} {0: 1, 1: 0, 2: 1, 3: 2, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!